Информация

Как да изчислим титъра на вируса от qPCR

Как да изчислим титъра на вируса от qPCR


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Събрах малко лентивирус от 293T клетки и искам да титрувам резултата. Инфектирах 293Т клетки на ямкова плака с 400 000 клетки на ямка, която заразих с вирусен запас, и 1 на 10, 100 и 1000 разреждания (както и няколко неинфектирани гнезда). След 72 h инкубация аз трипсинизирах клетките и първо използвах FACS за титруване, но 293T не експресират промотора, под който GFP се намира в някои проби и следователно те не се появяват във FACS. Като алтернатива, аз извличах геномната ДНК от всички проби, използвайки комплект QIAGEN DNeasy (също пробите, които вече успях да титрувам чрез FACS) и след това извърших qPCR върху тях.

Използвах ABI PRISM 7000 SDS: http://www.cgenetool.com/products/abi_prism_7000.shtml

Включени в PCR плаката бяха:

  • Стандарти за брой: 1000, 10k, 100k, 1м копия
  • Проби в три екземпляра
  • Контроли без шаблон, както и нетрансдуцирани контроли

Всеки от тях беше удвоен, веднъж с праймери и сонда за WPRE (елемент, специфичен за лентивируса) и веднъж с праймери и сонда за бета-актин (домакински ген, присъстващ във всички клетки).

Резултатите, върнати от машината, включват за всяка ямка цикъла, при който се пресича праговата флуоресценция - заедно с автоматично изчисленото количество копия (което софтуерът изчислява според стандартите, които приемам).

Тъй като нарекох триизмерните проби идентично, той също автоматично изчисли средното количество сред всеки три екземпляра (практически, а?). Проверих дали има отклонения, които трябваше да бъдат изключени от средствата, но всичко беше наред.

Така че сега например имам резултат от 700k за количеството WPRE в проба А. Количеството бета-актин в проба А е 6,82 x 106. Трансфекцията е 400 000 клетки на ямка, проба А се трансфектира с 10 ul вирусен материал, разреден 1: 100.

Как да изчисля титъра на вируса на ml от това?

Получих формулата: WPRE Qty / (b-act Qty*0,5) * клетки в ямка (400k) * фактор на разреждане (100), но се мъча да разбера а) защо b-act Qty се дели на 2, б) дали резултатът ще бъде титър на вируса на uL или на 10uL (трансфекционен обем) и в) как бета-актинът може да има почти 107 копирайте последователно номера във всички проби, когато трябваше да има само около 105 клетки…


Тук имам 2 съмнения.

  1. Вие получавате вашите вируси от медиите, докато Actb измерванията могат да се извършват само в клетъчните лизати.
  2. Actb е само справка за нормализиране на броя на клетките: по -висок ще бъде вирусният титър поради по -големия брой заразени клетки. Но това е без значение, ако целта ви е лентивирусна трансдукция, където се интересувате само от получаване на стойности на титрите, а не от измерване на ефективността на нейното образуване.

Можете просто да направите qPCR с пробата от носителя и стандартите и да регресирате измерените стойности на Ct на пробите, за да получите титри.


Вашият метод ми се струва прекалено сложен. Сигурно имате контролен вирус? Бих препоръчал конститутивно изразена GFP конструкция, за да я направи съвместима с FACS анализа. Използвайте вируса GFP, за да изчислите директно вирусния титър чрез FACS, след което проверете другите си вируси чрез анализ на плака.


След като придобих много повече опит с това как работят изследванията, сега мога да си отговоря:

а) количеството бета-актин се дели на 2, тъй като това е човешки ген и следователно присъства два пъти в клетките на бозайници, разделянето му на 2 дава оценка на броя на наличните клетки.

б) Резултатът дава оценка от колко вирусни копия ще се озоват в клетките количеството на използвания вирусен разтвор - следователно, ако това е 10 uL от разреждане 1: 100, това представлява 0,1 uL чист вирусен разтвор. Така че единицата на резултата в този случай ще бъде "вирусни инфекции на 0,1 uL".

в) Броят на бета-актиновите копия не съответства на броя на първоначално засетите клетки. 400 000 клетки, които се удвояват веднъж за приблизително 24 часа, биха направили 3,2 m клетки след 72 часа (3,2x106), така че това не е твърде далеч от номера на копието.


а) Триптонов агар:-
Добавете 10 г триптон, 0,01-0,03 М калциев хлорид (реагент), 5 г натриев хлорид и 11 г агар в 1 л вода. Загрява се с често разбъркване и се вари 1 минута, за да се разтвори напълно прахът. Автоклавирайте при 121 ° С за 15 минути.
б) Триптонов бульон:-
Приготвен както по -горе без добавяне на агар в средата.
в) Триптонов мек агар:-
Добавете 10 г триптон, 5 мл калиев хлорид и 9 г агар в 1 л вода. Загрява се при често разбъркване и се вари 1 минута, за да се разтвори напълно праха. Автоклавирайте при 121°C за 15 минути.

Тъй като вирусите могат да нараснат до невероятно високи концентрации, трябва да ги разредим, за да ги преброим ефективно. Извършете разреждане на културата на бактериофага.
Етикетирайте всички епруветки и среда за разреждане, както следва. Всяка епруветка представлява десеткратно разреждане на вируса
а) Пет триптонови меки агарови тръби: 10 -5, 10 -6, 10 -7, 10 -8, 10 -9
б) Пет триптонови плочки с твърд агар: 10-5, 10-6, 10-7, 10-8, 10-9
в) Десет епруветки с бульон от триптон: 10 -1 до 10 -10

Серийно разреждане

  • Сложете ръкавици, напълнете 9 ml триптонов бульон в десет епруветки за култура, обозначени като 10 -1 до 10 -10. Тези епруветки ще се използват за вирусни серийни разреждания.
  • Вземете 1 ml от фаговата култура, която искате да титрувате, и я прехвърлете в епруветката, озаглавена 10 -1 с пипета. Разбъркайте добре епруветката. Това е първото ви десеткратно разреждане (т.е. разреждане 1 на 10)
  • Вземете 1 ml от смесената култура от епруветката с етикет 10 -1 и я прехвърлете с нова пипета в следващата епруветка, обозначена с 10 -2. Смесете и тази тръба.
  • Продължете този модел, за да създадете серия от серийни разреждания. В крайна сметка ще получите 9 епруветки с 9 ml и 1 епруветка с 10 ml. Вирусните натоварвания във вашите епруветки ще бъдат разредени от 10 пъти (вашата първа епруветка) или 100 пъти (вашата втора епруветка) до десет милиарда пъти (последната ви епруветка).

Подготовка на чинии

  • Вземете пет епруветки с мек триптонов агар и пет плочи на Петри, обозначени като 10 -5 до 10 -9
  • Поставете петте епруветки с мек триптонов агар с етикет във водна баня. Водата трябва да е с дълбочина малко над тази на агара в епруветките. Доведете водната баня до 100 ° C, за да се разтопи агарът. Охладете и поддържайте разтопеният агар при 45˚C. Това ще гарантира, че вашият агар не се втвърдява в епруветките, преди да имате възможност да го излеете в петриевите блюда.
  • Асептично прехвърлете две капки от Escheria coli B култура с пастьорова пипета към агара и го разбъркайте внимателно. Това са бактериите, които ще бъдат убити, което ви позволява да преброите броя на вирусните частици в определен разтвор.
  • Добавете 0,1 ml от всяко серийно разреждане в съответната мека агарова епруветка, докато епруветките са още в банята с гореща вода. Например, 0,1 ml от вашето серийно разреждане 10 -5 трябва да отиде в епруветката с мек агар, обозначена с 10 -5.
  • Използвайки отделни пастеровски пипети и стерилни накрайници на пипети, повторете предишната стъпка за епруветките за разреждане на фаг с триптонов бульон, обозначени с 10 -6 до 10 -9.
  • Смесете епруветките добре и след това изсипете всяка епруветка в плочата на Петри със съответния етикет. Това ще създаде тънък слой агар, който е инокулиран с бактерии и вируси във всяка чиния. Инкубирайте всички култури на плочи в обърнато положение за 24 часа при 37 .C

Преброяване и изчисляване на титри

Вирусният титър е количествено измерване на биологичната активност на вашия вирус и се изразява като плакообразуващи единици (pfu) на ml.
За да се изчисли титърът на вируса,

  • Извадете чиниите си от инкубатора и ги разгледайте. Трябва да видите облачни области в цялата плоча, където са се развили бактерии, с изключение на малки ясни петна, наречени плаки. Тези плаки са петна от мъртви бактерии и всяка плака представлява един вирус.
  • Намерете плоча с 30 до 300 плаки и пребройте точния брой плаки върху тази плоча.
  • След това използвайте следната формула, за да определите титъра (pfu/ml) на вашия вирусен запас.

Където, d = разреждане
v = обемът на разреден вирус, добавен към плаката

Примерно изчисление:


& bull Средно 50 плаки, образувани в гнездата за разреждане 1: 10 000
& bull Добавен обем разреден вирус: 0,2 ml

За съжаление, тази виртуална лаборатория изисква Adobe Flash player. Моля, вижте допълнителна информация, ако това не работи на вашия компютър

На GNU/Linux машини, моля, вижте подходящата онлайн помощ. Например,


Какво е Cq Стойност?

PCR в реално време (често наричан qPCR) обикновено се провежда за количествено определяне на абсолютното количество на целевата последователност или за сравняване на относителните количества от целевата последователност между пробите. Тази техника следи усилването на целта в реално време чрез специфичен за целта флуоресцентен сигнал, излъчван по време на усилването.

Въпреки факта, че PCR флуоресцентните багрила и сонди в реално време трябва да бъдат специфични за последователността, значително количество флуоресценция на фона се появява по време на повечето PCR експерименти в реално време. Важно е да се заобиколи или отчете този фонов сигнал, за да се събере значима информация за вашата цел. Този проблем се решава от две стойности в PCR в реално време: праговата линия и CT стойност.

  1. Праговата линия е нивото на откриване или точката, в която реакцията достига флуоресцентен интензитет над фоновите нива. Преди да извършите PCR, вие (или софтуерът във вашия цикъл) задавате прагово ниво. Това е буквално линия във вашата графика, която представлява ниво над фоновата флуоресценция, която също пресича вашата реакционна крива някъде в началото на нейната експоненциална фаза (Фигура 1).
  2. Cq стойност е номерът на PCR цикъла, при който реакционната крива на вашата проба пресича праговата линия. Тази стойност показва колко цикъла са били необходими за откриване на реален сигнал от вашите проби. PCR тестовете в реално време ще имат реакционна крива за всяка проба и следователно много Cq стойности. Софтуерът на вашия велосипедист изчислява и изобразява стойността на Cq за всяка от вашите проби.

Фигура 1. Прагово ниво и Cq стойност на PCR крива на амплификация в реално време.

° Сq стойностите са обратни на количеството целева нуклеинова киселина, която е във вашата проба, и корелират с броя на целевите копия във вашата проба. Долна Cq стойностите (обикновено под 29 цикъла) показват големи количества от целевата последователност. По-високо Cq стойности (над 38 цикъла) означават по -ниски количества от вашата целева нуклеинова киселина. Висока Cq стойностите също могат да показват проблеми с целта или настройката на PCR, както е посочено по-късно в раздела за подводните камъни на тази статия.

Вашият PCR инструмент ще събира флуоресцентни данни по време на всеки цикъл. След около 15 цикъла ще имате добра представа за вашето фоново ниво на флуоресценция – това ще се появи като права линия, започваща от нулевата точка на цикъла. Праговото ниво ще бъде точно над това, но в точката, където вашите проби започват да преминават в експоненциалната фаза на PCR амплификация. Днес компютърният софтуер изчислява точно тази точка и всички съвременни велосипедисти в реално време имат автоматична настройка на праговата линия.

PCR в реално време записва количеството флуоресценция, излъчвана по време на реакцията, където всички PCR компоненти са в изобилие. По този начин C.q стойностите обикновено са последователни за всички повторения в PCR в реално време. Когато се достигне крайната точка на PCR реакцията, натрупаните инхибитори, инактивирани полимерази и ограничаващи реагенти създават много вариации в стойностите на крайната точка и ето защо конвенционалната PCR не може да се използва количествено.


Как се определя вирусният титър във VectorBuilder? След събиране на вирусни частици, ако вирусният вектор носи флуоресцентен репортерен ген, обикновено първо проверяваме качеството на вируса, като трансдуцираме вируса в някои общи клетъчни линии (например 293T или 293A), за да наблюдаваме експресията на флуоресцентен протеин. След това се използват различни методи за количествено определяне на титъра на вируса в зависимост от вида на вируса. Понякога, ако има голямо разминаване между флуоресцентното наблюдение и количественото измерване, ние ще извършим повторно измерване или допълнителна валидация, за да гарантираме, че вирусите, произведени от VectorBuilder, са с високо качество.

Lentivirus

Използваме p24 Elisa за измерване на титъра на лентивирус. Този метод използва сандвич имуноанализ за измерване на нивата на основния протеин на HIV-1 p24 в лентивирусни супернатанти. Лентивирусните проби първо се добавят към микротитърна чиния, кладенчетата на която са покрити с анти-HIV-1 р24 улавящо антитяло, за да се свърже р24 в пробите от лентивирус. Това е последвано от добавяне на биотинилирано анти-р24 вторично антитяло, което от своя страна се свързва с р24, улавен от първото антитяло на плочата. След това се добавя конюгат стрептавидин-HRP за свързване на биотинилираното анти-р24 антитяло поради взаимодействието между стрептавидин и биотин. Към пробите в крайна сметка се добавя субстратен разтвор, който произвежда цвят при взаимодействие с HRP. Интензитетът на оцветения продукт е пропорционален на количеството p24, присъстващо във всяка лентивирусна проба, което се измерва с помощта на спектрофотометър и след това се определя точно количествено чрез сравняване с рекомбинантна HIV-1 p24 стандартна крива. След това стойността на p24 се корелира с вирусния титър на съответната лентивирусна проба.

Аденовирус

За аденовирус измерваме и функционалния титър. След трансдукция на серийно разреден аденовирус в клетки 293А, ние използваме имуноцитохимичен подход, за да преброим броя на клетките, които успешно се трансдуцират чрез откриване на аденовирус-специфичен хексонов протеин, и всяка имунооцветена клетка се счита за една инфекциозна единица. Клетките се заразяват при много ниска множественост на инфекцията (MOI), за да се гарантира, че повечето трансдуцирани клетки са заразени от една вирусна частица. Този анализ показва добра корелация с конвенционалния анализ на плаки. За ултрапречистен аденовирус директно измерваме оптичната плътност (използвайки OD260) на вирусните частици за оценка на титъра, тъй като съществува тясна връзка между оптичната плътност на ултрапречистения аденовирус и функционалния титър. Аденовирусът има много добра стабилност. В нашия препарат вирусните частици са по същество живи и могат да останат функционални при стайна температура в продължение на много дни.


1. Вземете средната стойност на стойностите на Ct за домакинския ген и тествания ген в експерименталните и контролните условия, като върнете 4 стойности. 4-те стойности са Експериментално тестван ген (TE), Ген, тестван контролен (TC), Експериментален ген за домакинство (HE) и Генен контрол на домакинството (HC).

Средна експериментална CT СтойностСреден експериментален CT СтойностСреден контрол CT СтойностСреден контрол CT Стойност Delta CT Стойност (експериментална) Delta C.T Стойност (контрол)
TEТОЙTCHC Delta CTE Delta CTC
21.2720.2319.6019.271.030.33

2. Изчислете разликите между експерименталните стойности (TE – HE) и контролните стойности (TC – HC). Това са вашите Delta Ct стойности съответно за експерименталните ( Delta CTE) и контролните ( Delta CTC) условия.

3. След това изчислете разликата между стойностите Delta CT за експерименталните и контролните условия ( Delta CTE - Delta CTC), за да достигнете до стойността на двойната делта Ct (ddCt).

4. Тъй като всички изчисления са в логаритъмна основа 2, всеки път, когато има два пъти повече ДНК, вашите Ct стойности намаляват с 1 и няма да се намалят наполовина. Трябва да изчислите стойността на 2 ^<-2 Delta Delta C_> за да се промени промяната на израза.

dCt стойност (експериментално)dCt стойност (контрол)ddCt стойностПромяна на сгъване на израза
dCTEdCTCddCt2^-ddCt
1.030.330.700.615572207


Как да изчислим титъра на вируса от qPCR Ct?

Трябва да изчисля титрите на вируса от qPCR Ct в моя клас по микробиология и не мога да намеря никаква информация как да направя това, чудя се дали някой тук може да помогне?

Например, ако Ct е 23.53, как да го конвертирам в титър?

Имате ли стандарти за сравнение?

да. Имате нужда от стандарти за абсолютно количествено определяне. Ct стойностите сами по себе си ще ви кажат само кои проби имат повече или по -малко от вашия GOI.

Трябва да начертаете своите стандарти на стандартна крива, след което да начертаете неизвестното. Много софтуер за анализ на qpcr ще направи това вместо вас, ако поставите заглавието на стандартите.

Технически не можете да изчислите титъра на вируса от qPCR. Можете да получите номера на копия, които могат да се равняват на частици.

За да получите титър, трябва да добавите известен обем вирус към клетките и да определите PFU/mL.

Ако се опитвате да намерите копия, както са казали други, имате нужда от стандартна крива.


Каква е стойността на Ct?

Стойността на прага на цикъла (Ct) на реакцията се определя като номер на цикъла, когато флуоресценцията на PCR продукт може да бъде открита над фоновия сигнал. За да се изчисли стойността на Ct, е необходимо да се начертае хоризонтална линия (праг) върху графиката за усилване. Поставянето на тази линия често се определя от qPCR софтуера, но потребителите могат ръчно да поставят тази линия. В идеалния случай прагът се поставя в точката, когато реакцията е в експоненциална фаза, поради което няма да се бърка с фоновия сигнал.

Разглеждайки горния пример, може да се види, че номерът на цикъла, когато прагът пресича графика на усилване, е 19. Следователно стойността на Ct ще бъде 19 в този случай.

Стойността на Ct се свързва с количеството PCR продукт в реакцията. Колкото по -ниска е стойността на Ct, толкова повече PCR продукт присъства. Това е така, защото са необходими по -малко PCR цикли, за да може този продукт да бъде открит във фонов сигнал.


Защо RT-PCR, qPCR и RT-qPCR не са едно и също?

При обсъждането на тази тема е важно да се подчертае често срещаното погрешно схващане, че RT-PCR, qPCR и RT-qPCR са синоними. Всъщност приликите между тясно свързани техники често водят до неправилно използване на съкращенията. В опит да се предотврати това, насоките за минимална информация за публикуване на количествени експерименти за PCR в реално време (MIQE), публикувани за първи път през 2009 г., предлагат стандартизация на съкращенията. Те заявиха, че „RT-PCR“ трябва да се използва само за описване на PCR с обратна транскрипция, а не PCR в реално време, както често се бърка. PCR с обратна транскрипция позволява използването на РНК като матрица за генериране на комплементарна ДНК (кДНК). С помощта на ензима обратна транскриптаза се генерира едноверижно копие на сДНК. След това това може да бъде амплифицирано от ДНК полимераза, генерирайки двуверижна сДНК, подаване в стандартен PCR-базиран процес на амплификация (виж Фигура 1А). Тази техника може да се използва при молекулярно клониране на гени, представляващи интерес (GOI), но най-често тя служи като първа стъпка в RT-qPCR. Според MIQE, акронимът „qPCR“ описва количествена PCR в реално време, която е PCR амплификация на ДНК в реално време, измерена с флуоресцентна сонда, най-често интеркалиращо багрило или сонда на базата на хидролиза, позволяваща количествено определяне на PCR продукт (вижте Фигура 1В). Тази техника се използва за откриване на наличието на патогени и за определяне на броя на копията на ДНК последователности, които представляват интерес. Крайният акроним „RT-qPCR“ се използва за количествена PCR в реално време за обратна транскрипция. Това е техника, която комбинира RT-PCR с qPCR, за да позволи измерване на нивата на РНК чрез използването на cDNA в реакция на qPCR, като по този начин позволява бързо откриване на промени в генната експресия (виж Фигура 1С). Въпреки тези стандартизирани съкращения, важно е да се отбележи, че тази насока за номенклатура не винаги се спазва и qPCR обикновено се използва за описание на RT-qPCR. По същия начин RT се използва за обозначаване на PCR в реално време, а не за обратна транскрипция, като по този начин предизвиква объркване относно метода, който се описва. За това ръководство за начинаещи ще използваме съкращенията MIQE, както е описано по-горе.

Схематично сравнение на RT-PCR, qPCR и RT-qPCR. (А) Работен процес на RT-PCR. РНК се изолира и сДНК се генерира чрез обратна транскрипция (RT) След това се провежда PCR за амплифициране на областите от интерес. (B) qPCR схема. ДНК се изолира и усилената амплификация се определя количествено с помощта на сонда, която флуоресцира при интеркалация с двуверижна ДНК. (C) RT-qPCR процедура. РНК се изолира и кДНК се генерира преди започване на qPCR процедура.


Алтернативни методи за нормализиране

Докато нормализирането към референтни гени е най-често срещаният метод за нормализиране на анализа, има ситуации, в които този подход не е подходящ, като например когато трябва да се сравняват голям брой гени в хетерогенна група проби или при профилиране на miRNA. При тези сценарии е необходимо да се приеме алтернативна стратегия.

Нормализиране на масата на тъканта или клетъчния номер

Измерването на броя на клетките или тъканната маса, които да се използват като нормализиращ фактор, не е толкова просто, колкото изглежда на пръв поглед. Експериментите с клетъчни култури са сравнително лесни за нормализиране въз основа на броя на клетките. Въпреки това, добавянето на лечение може да повлияе на клетъчната морфология, усложнявайки съотношението на клетъчния брой към общата РНК/гени, експресирани в сравнение с контролната култура. Експерименталното третиране може да доведе до производство на извънклетъчна матрица, причинявайки разлики в ефективността на извличане на нуклеинова киселина.

Биологичните тъкани могат да бъдат силно хетерогенни вътре и между субектите, като се наблюдават повече вариации, когато здравата тъкан се сравнява с болната тъкан. Дори очевидно по-малко сложните тъкани, като кръвта, могат да се различават значително по брой клетки и състав, така че генната експресия варира значително между привидно здравите донори 18 .

Всяко забавяне в процесите, използвани за пречистване на нуклеинова киселина, ще доведе до промени в измерената РНК. Например, забавянето на обработката на мононуклеарни клетки от периферна кръв и извличането на РНК от клетките води до значителни промени в генната експресия 19. Методите, лежащи в основата на процедурите за извличане, също са основен източник на технически вариации. Дори процесът на изолиране, избран за вземане на проби от клетки, получени от кръв, и пречистване на РНК води до различия в очевидните профили на генна експресия 20. Следователно първото съображение за нормализиране е да се гарантира, че събирането и обработката са абсолютно еднакви за всички проби. След това е от решаващо значение да се извърши достатъчен контрол на качеството, за да се уверите в концентрацията, целостта и чистотата на пробата (Пречистване на пробата и оценка на качеството и свързаните с тях протоколи в Приложение А).

Нормализиране към концентрацията на РНК

Като минимум, оценката на концентрацията на матрицата (ДНК за qPCR или РНК за RT-qPCR) е важна и, както е споменато в Пречистването и оценката на пробата, от решаващо значение е да се гарантира, че един и същ инструмент се използва за всички измервания, тъй като определянето концентрацията на нуклеинова киселина също е променлива и зависи от техниката.

При измерване на общата концентрация на РНК, по -голямата част от пробата се състои от рРНК, като само малка част се състои от интересуващата се иРНК при изследване на генната експресия или sncRNA при изследване на регулацията на генната експресия. Това означава, че ако концентрацията на рРНК се увеличи малко, но иРНК остава постоянна, общата концентрация на РНК ще се увеличи. Концентрацията на иРНК трябва да се увеличи значително, за да предизвика видимо увеличение на общата концентрация на РНК. Следователно, концентрацията на рРНК е ненадеждна мярка за концентрацията на тРНК, но за много протоколи е необходима еднаква концентрация на РНК, за да се осигури точна обратна транскрипция (вижте Обратна транскрипция).

Нормализиране на глобалната генна експресия

Когато измерва голям брой цели, анализаторът може да оцени глобалната средна стойност на общата генна експресия и да идентифицира регулирани РНК последователности, които се отклоняват от тази средна стойност. Този подход обикновено се използва за нормализиране на генни експресионни масиви. Това е ценна алтернатива на използването на референтни гени и може да бъде за предпочитане, когато се измерват много цели.

Друг наскоро проучен подход е измерването на ендогенно експресирани повтарящи се елементи (ERE), които присъстват в много от тРНК. Много видове съдържат тези повтарящи се елементи (ALU при примати, B елементи при мишки), които могат да осигурят оценка на фракцията на тРНК. Доказано е, че измерването на тези целеви последователности работи като конвенционални нормализиращи системи 9 (Le Bert, et al., в подготовка) и може да предложи универсално решение или алтернатива за сложни експерименти, при които стабилни референтни генни комбинации са недостъпни.

Нормализиране на miRNA данни

Все още няма съобщения за универсален референтен ген на miRNA. Следователно изборът на система за нормализиране все още е по-скоро емпиричен. Когато е възможно, стабилни инвариантни miRNAs могат да бъдат идентифицирани от подходи за целия геном, т.е., микрочипове. Малките нуклеоларни РНК (snoRNAs) също са използвани като референтни гени. Глобалната генна експресия е също полезен метод за нормализиране на експресията на miRNA, когато стабилна референция е неизвестна и са анализирани няколкостотин мишени 21,22,23. Този метод е по -подходящ за тези, които използват подходи, водещи до улавяне на всички miRNAs като cDNA в мултиплексирана форма, например Exiqon и miQPCR системи (вижте Castoldi et al. В PCR Technologies, Current Innovations 24).

Биологични и технически повторения

Целта на нормализирането е да се избегнат систематични грешки и да се намали променливостта на данните за евентуален статистически анализ. Друг важен аспект при създаването на данни за статистически анализ е използването на реплики на данни.

Биологичните копия са абсолютно необходими за статистически анализ. Нивата на статистическа значимост често се определят на границата от 5% значимост. За биологични ефекти, близки до такова ниво на значимост, може да е необходимо да има поне 20 биологични повторения, за да се определи нивото на значимост на анализа (1:20, съответстващо на 5%). Всъщност се предполага, че е необходимо да се запишат поне 50 пъти броя на наблюденията за точна оценка на значимост 25, т.е. от порядъка на хиляда биологични проби. Естествено, практическите ограничения рядко позволяват биологични репликации на тези нива. Освен това точните оценки на броя на необходимите биологични повторения, за да се отговори на дадено ниво на значимост, също зависят от нивото на променливост на данните. Въпреки това е важно да се осъзнае, че често срещана грешка е да се подценява необходимия брой биологични повторения, за да може да се стигне до надеждни заключения. Препоръчва се да се извърши първоначално пилотно проучване, за да се оцени присъщата променливост на анализа и потенциалният размер на наблюдавания биологичен ефект, за да има добра основа за оценка на необходимия брой биологични повторения 26.

Техническите реплики не се използват директно за статистическия анализ. Вместо това техническите копия се използват за архивиране на проби (в случай че някои проби бъдат загубени в процеса на техническа обработка) и за подобряване на оценката на точността на данните. Техническите репликации могат да подобрят точността на данните, ако е вярно предположението, че те варират стохастично около точното измерване на всеки етап от процеса на техническо обработване. Средната стойност на техническите повторения е по -близо до точното измерване. Ефектът от осредняването на техническите повторения може да бъде илюстриран чрез отбелязване на размера на доверителния интервал в симулиран набор от данни с предварително определена променливост, т.е. стандартно отклонение, зададено на единица. Както се вижда в Таблица 10.4, доверителният интервал става по -малък с нарастващ брой технически повторения (проби), което показва по -точна оценка на точното измерване. Освен това стесняването на доверителния интервал е най -драматично при малкия брой технически повторения. Увеличаването на броя на повторенията от 2–3 намалява доверителния интервал от 8,99–2,48, т.е. повече от 3 пъти подобряване на прецизността в оценката на точното измерване. Докато допълнителни повторения продължават да подобряват оценката на точността на измерването, ефектът е с намаляваща величина. Следователно е очевидно, че в случаите, когато техническата променливост е проблем, може да бъде голямо предимство да се използват три екземпляра, а не дубликати.

Техническите копия могат да бъдат събрани на няколко етапа през целия процес на обработка на пробата, включително екстракция на РНК, обратна транскрипция и откриване на qPCR. Ако технически повторения бъдат открити на няколко етапа, се генерира вложен експериментален дизайн. Пилотно проучване, което се възползва от вложен експериментален дизайн, може да помогне за идентифициране на етапите на обработка на пробите, които допринасят най -много за техническите грешки при обработката, и на базата на тази информация може да се изчисли оптимален план за вземане на проби 27.


QPCR анализ в реално време за титъра на TYLCV във връзка със скали за тежест на заболяването, базирани на симптоми.

През последните няколко десетилетия болестта на доматеното жълто къдрене на листата (TYLCD) доведе до тежки загуби на добив и повишена заболеваемост в тропическите и субтропичните региони. В Оман е установено, че шест различни вида бегомовируси са свързани с TYLCD. Вирусът на доматено жълто къдрене на листата- Оман (TYLCV-OM) обаче е най-разпространеният вид в цялата страна. Количествен PCR (qPCR) анализ в реално време с вътрешен контрол [фактор за удължаване на домати 1 (EF1)] е разработен за TYLCV-OM, на базата на SYBRGreen химията за бързо откриване и количествено определяне на вируса. Този анализ е извършен върху полеви проби, показващи симптоми съгласно скалите за тежест на заболяването на Световния център за зеленчуци (AVRDC). Тестът е използван за установяване на връзка между вирусното натоварване и фенотипните симптоми. Вирусни копия от 2,88 x 109 бяха открити в заразени с домати растения, показващи тежестта на симптомите според AVRDC скала „3“ (т.е. силно свиване на листата и пожълтяване на листата).

Броят на копията на вируса намалява с относителното намаляване на скалата на тежестта на симптомите. Доматените растения, показващи скала „1“ и „2“, имат съответно 7,7 x 104 и 7,47 x 106 вирусни копия. Много нисък брой копия на вируса (564) е открит в доматени растения, показващи симптоми при скала на тежест „0“, които очевидно са без симптоми. Въпреки това, доматените растения, развити чрез тъканна култура в стерилизирани условия, които са използвани като отрицателна контрола, не показват наличието на вируса. Разработеният qPCR анализ може да открие до 18 fg (фемтограма) вирус от общата нуклеинова киселина, еквивалентна на приблизително 30 геномни единици. Този количествен анализ може да се използва за определяне на вирусния титър, в размножителни програми за развитие на устойчиви на вируси растения и за епидемиологични изследвания за наблюдение на вирусните популации и техния интензитет.

Ключови думи: TYLCV Lycopersicon esculentum

Доматите са сериозно засегнати от болестта на къдрените листа на домати (TYLCD), която е едно от най -разрушителните вирусни заболявания в света. TYLCD също се превърна в основен ограничаващ фактор за производството на домати в различни региони на Близкия изток и Югоизточна Азия, Африка, Европа (Czosnek и Laterrot, 1997 Moriones и Navas-Castillo, 2000) и други страни (Accotto et al., 2000, 2003). Няколко генетично свързани вида вируси, които принадлежат към рода Begomovirus от семейство Geminiviridae, са свързани с TYLCD. TYLCD причинява големи загуби на реколта, които могат да достигнат до 100%. Намаляването на производството на домати е свързано с TYLCD, откакто е описано за първи път в края на 30 -те години. Cohen and Harpaz (1964) reported TYLCD in the Jordan valley which has now become a serious problem infecting tomatoes worldwide. TYLCV alone or by mixed infections of different Begomovirus species is responsible for total yield loss in different countries.

TYLCV is the generic name given to the complex of viral species that cause the disease. According to the International Committee on Taxonomy of Viruses (ICTV), a complex of more than 12 different viral species and their strains are found to be linked with TYLCD (Fauquet et al., 2008). TYLCV is transmitted in a circulative, persistent manner by its vector whitefly (Bimisia tabaci) (Moriones and Navas-Castillo, 2000).

The genome of TYLCV is monopartite with a single genomic component, containing single-stranded DNA (ssDNA). The size of this ssDNA molecule is about 2.8 kb. Symptoms appear approximately 15 days after whitefly inoculation. Infected plants have small leaves that curl upward and turn yellow around the margins. Infected plants have short internodes, and stunted appearance. They show premature flower fall and loss of fruits. Fruits are small, but not misshaped. Infection of the plant at earlier stages results in a greater yield loss. Most of the wild tomato species, such as Lycopersicon hirsutum, L. chilense, L. pimpinellifolium, and L. peruvianum are symptomless carriers (Zakay et al., 1991). In Oman TYLCD is associated with six begomoviruses but the most prevalent virus is TYLCV-OM which is found associated with almost all cases of the disease (Khan et al., 2014).

The range of symptom severity on tomato plants infected with TYLCD under field conditions varies from mild to severe. The Asian Vegetable Research and Development Center (AVRDC), currently known as The World Vegetable Center (WVC), Taiwan has established a disease severity scale 0-3 (four scales) for recording symptom severity, where 0 = no visible symptoms 1 = light leaf yellowing of the leaflet margins 2 = moderate plant stunting with leaf yellowing and curling and 3 = Severe plant stunting with leaf curling and yellowing and cessation of plant growth (Lapidot et al., 1997 Lapidot and Friedmann, 2002). The scale is important in scoring susceptibility/resistance of tomato breeding lines under diverse climatic and growing conditions.

Highly sensitive tests are required for the detection and quantification of the virus in epidemiological studies to understand host range and virus-vector relationship. Moreover, these tests can also help in the selection of lines in breeding programs as well as in understanding the mechanism of resistance in resistant lines developed through conventional and genetic engineering approaches. Several methods have been established to detect and identify different Begomovirus species infecting tomato crops, like immunoblotting (Pico et al., 1999), conventional polymerase chain reaction (PCR) methods, including species-specific primers and restriction fragment length polymorphism (Accotto et al., 2000 Martinez-Culebras et al., 2001 Davino et al., 2008), loop-mediated isothermal amplification (Fukuta et al., 2003) and real-time quantitative (q)PCR (Mason et al., 2008). PCR is one of the methods used extensively for the detection of begomoviruses.

The major drawback of conventional PCR is that it cannot determine the exact quantity of the virus. Moreover, some plants are phenotypically normal and carry very low virus titers which are below the detection limit of conventional PCR. So there is a need to quantify viruses in symptomatic as well as non-symptomatic plants.

The use of qPCR for the identification and quantification of DNA/RNA viruses has now become more attractive due to its greater accuracy and speed compared with conventional/end-point PCR or serological methods (Mason et al., 2008 Papayiannis et al., 2010). The use of an internal control in qPCR exhibits stable expression at various experimental conditions and allows normalization between samples. This kind of normalization is very effective in direct comparisons between independent samples and to avoid false negative results by removing any sampling, extraction or amplification bias that could hamper the analyses. In qPCR, several chemistries are available which include DNA binding dyes such as SYBR Green I, hybridization probes, hydrolysis probes and molecular beacon (Mullis and Faloona, 1987 Mullis, 1990 Tan et al., 1994 Huang et al., 1995a).

Binding of the SYBER Green I to the minor grooves of double stranded (ds)DNA results in emission of fluorescence 1000 folds >its free form in solution (Huang et al., 1995b). Thus, there is a direct correlation of fluorescence and synthesis of dsDNA in the reaction tube. This fluorescence can be determined which serves as the measure of amplified product. This method is relatively cheap and easy to use. Melt curve analyses can determine any nonspecific product during the reaction. In experiment, the fluorescence of the sample can be measured containing known DNA amounts in parallel to actual experimental reactions. The logarithm (log) of the amount of the starting quantities (SQ)versus threshold cycle (Ct) is used to plot standard curves to evaluate the reaction efficiency and to calculate the amount of DNA present in the experimental samples.

In this study, the enhanced sensitivity and specificity of qPCR was exploited for rapid detection and quantitation of TYLCV-OM using SYBR Green chemistry. This assay was then used on field infected tomato samples falling in different disease severity scales of AVRDC and the virus titer was correlated with symptom severity.

Field samples infected with TYLCV-OM were collected in January 2014 from Al'Seeb wilayat of Muscat, Oman. The samples were categorized according to AVDRC disease severity scale 0-3 (Zhengxing, 1999). Ten samples of each scale were collected along with healthy tomato plants.

DNA Extraction for Template Preparation

Total DNA was extracted from 0.1 g fresh Begomovirus-infected plant leaves by CTAB method (Doyle and Doyle, 1987).

For conventional PCR, TYLCV-OM specific primer pair FC (GATGGGTTCCCCTGTGCGTGAATCCAT) and RC (GGACCAGCCTCCTCTTATAGAGAATAT) was used for the confirmation of TYLCV-OM infection in all selected samples with the amplified product of 300 bp designed on CP region. The primer pair QF-OM (GAAGCCCTGATGTTCCCCGTGG) and QR-OM (GATTTAACACAGAACCTCTTACC) was designed based on the CP gene of TYLCV-OM and was used in qPCR reactions. To validate and standardize qPCR, an internal control EF1 (EF1-F: TACTGGTGGTTTTGAAGCTG and EF1-R: AACTTCCTTCACGATTTCATCATA) was designed and used. Clustal X program (Thompson et al., 1997) was used for multiple alignments.

For the absolute quantification of CP gene, a plasmid containing the full-length TYLCV-OM clone (Acc. No. DQ644565) was quantified with NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific, USA) and serial dilutions were made to obtain a standard curve. The amount of viral DNA was used to calculate the copy number of the virus. The suitable amount of plasmid DNA was used to produce 1 X 109 copies of the virus and considered as stock. The stock sample was further 10-fold diluted to prepare five serial dilutions. A 10 ng uL-1 healthy tomato plant genomic DNA developed by tissue culture was also spiked in each serial dilution to get the same background as in field infected plants. All prepared standards were then aliquoted and frozen before being used as standards in each qPCR run. These serial dilutions were used to produce a standard curve.

The threshold cycle (Ct) value of three replicates of each standard-dilution and the log of the total DNA in each sample were used to obtain the standard curves by linear regression analysis.

A qPCR assay was done in Applied Biosystems(r) 7500 Real-Time PCR Systems (Life technologies, USA). The qPCR reaction mix consisted of (10 uL) of 1X Power SYBR Green master mix, 0.10 uL of each primer and 2.5 uL of DNA sample (10 ng uL-1). PCR reactions were carried out in clear optical plates in the ABI 7500 real time PCR detection system (USA).

Data analysis was done using ABI 7500 software v 2.0.6 for each template sample individually. The analysis includes the calculation of all parameters of the standard curves and their corresponding dissociation curves and also calculates the Ct values for each sample individually.

Infected Sample and Symptom Severity

During the field surveys, tomato plants exhibited a range of symptom severity (Fig. 1). The plants were categorized according to AVDRC disease severity scale (0-3). All plants showing symptom severity scale 1-3 upon PCR showed a band of 300bp indicative of the presence of Begomovirus infection. No amplification was observed in case of plants showing symptom severity scale 0 or healthy negative controls.

Primer Designing and Validation

The ClustalX program was used to make multiple sequence alignment of all TYLCV sequences available in the GenBank database reported from different geographical regions (Fig. 2). A list of viruses used in multiple alignment is given in Table 1. A highly conserved region in CP gene (co-ordinate 603-762) was selected for designing primers (Fig. 2). The amplicon size was 159 bp.

The other related and unrelated Begomovirus species were also checked by the primer QF-OM/QR-OM for their specificity and no amplification was obtained in any case either in conventional or qPCR assay (data not shown). More than 50 different TYLCV isolates from Oman were analyzed by multiple sequence alignment and indicated that all tested TYLCV sequences had a maximum of five nucleotide mismatches within the 159 bp of amplified region (Fig. 2).

The primer pair QF-OM/QR-OM was initially used to optimize qPCR profile and working concentrations on TYLCV-OM reference samples. For the optimization of the qPCR assays, various primer concentrations (2.5-10 pM) and annealing temperatures (50-65degC) were tested in a 15 uL reaction containing 2.5 uL (10 ng/uL) DNA template. 10 pM, 5 pM and 2.5 pM dilutions for both primer pairs were prepared for qPCR optimization. In case of QF-OM/QR-OM the primer concentration that yielded the highest reporter fluorescence with no dimer formations (100% efficiency) was 2.5 pM, while in case of the internal control primer pair EF1-F/EF1-R, the 10 pM concentration was found to be best. Melt curve analyses were studied in each run to see nonspecific amplifications. A single peak was observed in all cases indicative of the specific amplification.

Real-time qPCR Standard Curve

After optimization of all conditions, qPCR was programmed for 1 cycle at 94degC for 5 min, followed by 40 cycles each consisting of 30s at 94degC, 30s at 55degC and 30s at 72degC followed by a melt curve analysis starting from 55degC. Triplicate reactions of each sample were run. Each qPCR reaction was repeated thrice to ensure the reproducibility of results. The actual function of developed qPCR assay was the construction of quantification standard containing the five viral serial dilutions and the internal reporter gene. The plasmid containing full-length TYLCV-OM clone was quantified by nanodrop. The quantified plasmid was then serially diluted in 10-fold steps from 109 to 103 copies per uL. The Ct was automatically calculated by the ABI 7500 software. The efficiency of the reaction from the total nucleic acid (TNA) extracts was slightly higher (98.58%) than plasmid forms.

The Ct values of five10-fold serial dilution of TYLCV-OM plasmid was used to construct a standard curve, demonstrating the sensitivity and linearity of the technique. The Ct values were relative to the log starting quantity of template DNA and the qPCR efficiency. Plasmid and TNA from tomato plants infected with TYLCD was estimated by the formula E = [10-1/slope]-1, were 97.8% (slope: -3.367) and 98.58% (slope: -3.353), respectively.

Table 1: Accession numbers and origin of Begomoviruses used in the multiple sequence alignment

Accession No.###Acronym###Virus species###Origin

JN604488###TYLCV-[OM-DT2-12]###TYLCV###Mediterranean/Middle East, Iran

JN604484###TYLCV-[OM-KW1-12]###TYLCV###Mediterranean/Middle East, Iran

JN604485###TYLCV-[OM-KW2-12]###TYLCV###Mediterranean/Middle East, Iran

JN604486###TYLCV-[OM-KW3-12]###TYLCV###Mediterranean/Middle East, Iran

JN604487###TYLCV-[OM-DT1-12]###TYLCV###Mediterranean/Middle East, Iran

Sensitivity of Conventional and qPCR

The TYLCV-OM infected tomato DNA sample and TYLCV-OM plasmid DNA was used to compare the sensitivity of qPCR with conventional PCR. A 10-fold serial dilution of TNA (150 ng, 15 ng, 1.5 ng, 150 pg, 15 pg, 150 fg, 15 fg, 1.5 fg) from TYLCV-OM infected tomato plant was used as a template in qPCR and conventional PCR reactions. The minimum possible dilution accurately detected by conventional PCR was 150 pg, whereas qPCR was able to detect the last dilution point of 1.5 fg with Ct of 38.34. The qPCR reaction with 15 fg of template DNA was detected at a Ct of 34.95. In case of plasmid DNA, conventional PCR was limited to detect 3000 genomic units whereas qPCR detected as low as 30 genomic units. It was inferred from the observed results that the sensitivity of qPCR assay in detecting serial dilutions was 1000 times more (1:10-8) than the conventional PCR (1:10-5 Fig. 3).

Symptom Severity Scale and Virus Quantification

Before proceeding to qPCR, all field collected samples were first checked for the presence of TYLCV-OM by conventional PCR using the primer set FC and FR. All samples showing symptom severity scales of 1-3 showed the presence of TYLCV-OM, while no amplification was observed in case of samples showing a disease severity scale of 0 (Table 2). These results confirmed that TYLCV-OM is the prevalent virus and is present in all infected tomato plants in Oman. Five samples from each scale were selected for qPCR analysis. Each sample was run in five replicates.

The Ct values for scale 1were more than scale 2 and 3 (Fig. 4). Virus copies were detected in small amounts in tomato plants showing a symptom severity scale of 0. The amount of virus copies associated with samples from scale 0 was significantly lower (564) than other scales (Fig. 5). However, negative controls (DNA of healthy tomato developed by tissue culture) did not show any virus with the Ct value of 37.414 (Fig. 4 and Fig. 5). The Ct values were proportional to the log of starting quantity of template DNA and SYBR Green PCR efficiencies for the TYLCV-OM assays was 99.5% (slope: -3.884). The average value of virus detected for scale 0-3 ranged from 564-2.88 x109 with the Ct values ranged from 37-8, respectively.

Table 2: PCR-based detection of TYLCV-OM in tomato plants differing in the severity of TYLCV

AVRDC severity Scale###Sample size###PCR for TYLCV-OM

There was a positive correlation between disease severity scale and virus titer. Significant differences were found for viral accumulation between the different scales (Fig. 4). The field samples of scale 0 did not exhibit any visual symptoms (Fig. 1). Although conventional PCR fails to detect any virus in those sample but qPCR showed appreciable amount of viral DNA, yet 1000 fold <scale 1 (Fig. 5). These results showed that apparently healthy field samples had enough virus inoculum for the white flies to take up. The difference in viral copies of plants from scale 1 and 2 was relatively less as compared to other scales. The highest amount of virus titer was found in scale 3 with values reaching up to 2.88 x 109 (Fig. 5).

TYLCD has become the major limiting factor for tomato production in many warm and temperate regions worldwide by developing new recombinants. According to ICTV, TYLCD is a disease complex comprised of several different virus isolates/species which belong to the genus Begomovirus. Among various isolates responsible to TYLCD complex, currently TYLCV isolate has been reported as the most important Begomovirus species infecting Solanaceous and other vegetable crops in Europe and the Mediterranean Basin.

It is also believed that TYLCV has emerged somewhere in the Middle East and extends throughout the Mediterranean basin, Asia, Africa and America (Navas-Castillo et al., 1999 Accotto et al., 2003 Papayiannis et al., 2010 Davino et al., 2012 Khan et al., 2014).

The recent advancement of molecular diagnostic systems during the past few years has enabled rapid diagnosis of TYLCD in field. Similarly several conventional PCR and qPCR-based techniques have improved remarkably for the detection of various virus species (Accotto et al., 2000 Gorsane et al., 2005 Davino et al., 2009). The development of fluorescent methods for PCR and also the instruments like real-time which can monitor the amplification process is considered as a significant improvement in molecular biology. qPCR have been extensively used in various branches of life sciences during the past few years, which includes infectious disease detection in humans (Enbom et al., 2001), animals (Brinkhof et al., 2008) and plants (Boonham et al., 2004), differentiation of invertebrate biotypes within a species (Papayiannis et al., 2009) and mutation scanning (Wittwer et al., 2003).

In the present study a qPCR assay based on SYBR

Green chemistry was developed for the detection and quantification of TYLCV-OM and successfully applied on TYLCD affected tomato plants from a field showing different severity scales. The data presented here showed the sensitive and specific detection/amplification of TYLCV-OM and there was a positive correlation between virus titer and symptom severity. During the development of this assay, it was ensured that no cross-reaction occurred between different TYLCV species isolated from Oman. The developed assay was also compared with conventional PCR for its sensitivity. Results showed that qPCR assay developed in this study can detect virus down to a dilution of 1:10-8 1000 times more sensitive than conventional PCR. Our results have shown that plants from symptom severity scale 0, which were asymptomatic, carry small amount of the virus. Conventional PCR failed to detect virus however, qPCR was sensitive enough to detect such low virus copies in plants showing a symptom severity scale of 0.

These results are highly significant and indicate that TYLCD is present in the filed in apparently healthy plants. These plants though remain symptomless but can serve as a reservoir of viruses where their vector can carry and transmit these viruses to other hosts. The greater specificity and sensitivity of developed qPCR assay can thus be used in such samples/hosts where conventional PCR fail to detect virus as shown in this study.

In the present study, we have developed a specific qPCR method for detection/quantification of TYLCV - OM and the relative amount of virus levels in field infected plants has been evaluated. The developed assay can also be used for other related hosts of TYLCV -OM from Solanaceae family like pepper, chili, tobacco and alternative hosts like weeds. The practical use of hazardous compounds like ethidium bromide for the pre - and post-amplification detection by gel electrophoresis could be minimized by using the assay developed in this study. Moreover, this method can be used to detect and quantify virus in those hosts where virus titer is lower than the detection limit of conventional methods. Therefore, this assay can be used in breeding programs for the identification of sources of resistant and for epidemiological surveys to monitor viral spread and population.

It is speculated that all worldwide TYLCV isolates which share similar or identical nucleotide mismatches could be accurately detected and quantified by the developed TYLCV qPCR assay.

Authors would like to acknowledge Sultan Qaboos University for the financial support of this study.

Accotto, G.P., M. Bragaloni, D. Luison, S. Davino and M. Davino, 2003. First report of Tomato yellow leaf curl virus (TYLCV) in Italy. Plant Pathol., 52: 799

Accotto, G.P., J. Navas-Castillo, E. Noris, E. Moriones and D. Louro, 2000. Typing of tomato yellow leaf curl viruses in Europe. Евро. J. Plant Pathol., 106: 179-186

Boonham, N., L. Gonzalez Perez, M.S. Mendez, E. Lilia Peralta, A. Blockley, K. Walsh, I. Barker and R.A. Mumford, 2004. Development of a real-time RT-PCR assay for the detection of Potato spindle tuber viroid. J. Virol. Methods, 116: 139-146

Brinkhof, J.M.A., C. van Maanen, R. Wigger, K. Peterson and D.J. Houwers, 2008. Specific detection of small ruminant lentiviral nucleic acid sequences located in the proviral long terminal repeat and leader-gag regions using real-time polymerase chain reaction. J. Virol. Methods, 147: 338-344

Cohen, S. and I. Harpaz, 1964. Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Ентомол. Exp. Appl., 7: 155-166

Czosnek, H. and H. Laterrot, 1997. A worldwide survey of tomato yellow leaf curl viruses. Арх. Virol., 142: 1391-1406

Davino, S., G.P. Accotto, V. Masenga, L. Torta and M. Davino, 2009. Basil (Ocimum basilicum), a new host of Pepino mosaic virus. Plant Pathol., 58: 407

Davino, S., M. Davino and G.P. Accotto, 2008. A single-tube PCR assay for detecting viruses and their recombinants that cause tomato yellow leaf curl disease in the Mediterranean basin. J. Virol. Methods, 147: 93-98

Davino, S., L. Miozzi, S. Panno, L. Rubio, M. Davino and G.P. Accotto, 2012. Recombination profiles between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in laboratory and field conditions: Evolutionary and taxonomic implications. J. Gen. Virol., 93: 2712-2717

Doyle, J.J. and J.L. Doyle, 1987. A rapid DNA isolation procedure for small amount of fresh leaf tissue. Фитохим. Bull., 19: 11-15

Enbom, M., A. Strand, K.I. Falk and A. Linde, 2001. Detection of epstein- barr virus, but not human herpesvirus 8, DNA in cervical secretions from Swedish women by real-time polymerase chain reaction. секс. Transmitted Dis., 28: 300-306

Fauquet, C.M., R.W. Briddon, J.K. Brown, E. Moriones, J. Stanley, M. Zerbini and X. Zhou, 2008. Geminivirus strain demarcation and nomenclature. Арх. Virol., 153: 783-821

Fukuta, S., T. Iida, Y. Mizukami, A. Ishida, J. Ueda, M. Kanbe and Y. Ishimoto, 2003. Detection of Japanese yam mosaic virus by RT- LAMP. Арх. Virol., 148: 1713-1720

Gorsane, F., S. Gharsallah-Chouchene, M.K. Nakhla, I. Fekih-Hassan, D.P. Maxwell, M. Marrakchi and H. Fakhfakh, 2005. Simultaneous and rapid differentiation of members of the tomato yellow leaf curl virus complex by multiplex PCR. J. Plant Pathol., 87: 43-48

Huang, S.K., H.Q. Xiao, J. Kleine-Tebbe, G. Paciotti, D.G. Marsh, L.M. Lichtenstein and M.C. Liu, 1995a. IL-13 expression at the sites of allergen challenge in patients with asthma. J. Immunol., 155: 2688-2694

Huang, S.K., M. Yi, E. Palmer and D.G. Marsh, 1995b. A dominant T cell receptor b-chain in response to a short ragweed allergen, Amb a 5. J. Immunol., 154: 6157-6162

Khan, A.J., S. Mansoor and R.W. Briddon, 2014. Oman: A case for a sink of begomoviruses of geographically diverse origins. Trends Plant Sci., 19: 67-70

Lapidot, M. and M. Friedmann, 2002. Breeding for resistance to whitefly-transmitted geminiviruses. Ан. Прилож. Biol., 140: 109-127

Lapidot, M., M. Friedmann, O. Lachman, A. Yehezkel, S. Nahon, S. Cohen and M. Pilowsky, 1997. Comparison of resistance level to tomato yellow leaf curl virus among commercial cultivars and breeding lines. Plant Dis., 81: 1425-1428

Martinez-Culebras, P.V., I. Font and C. Jorda, 2001. A rapid PCR method to discriminate between Tomato yellow leaf curl virus isolates. Ан. Прилож. Biol., 139: 251-257

Mason, G., P. Caciagli, G.P. Accotto and E. Noris, 2008. Real-time PCR for the quantitation of Tomato yellow leaf curl Sardinia virus in tomato plants and in Bemisia tabaci. J. Virol. Methods, 147: 282-289

Moriones, E. and J. Navas-Castillo, 2000. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res., 71: 123-134

Mullis, K.B., 1990. The unusual origin of the polymerase chain reaction. Sci. American, 262: 56-65

Mullis, K.B. and F.A. Faloona, 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. MethodsEnzymol., 155:335-350

Navas-Castillo, J., S. Sanchez-Campos, J.A. Diaz, E. Saez-Alonso and E. Moriones, 1999. Tomato yellow leaf curl virus-is causes a novel disease of common bean and severe epidemics in tomato in Spain. Plant Dis., 83: 29-32

Papayiannis, L.C., J.K. Brown, N.A. Seraphides, M. Hadjistylli, N. Ioannou and N.I. Katis, 2009. A real-time PCR assay to differentiate the B and Q biotypes of the Bemisia tabaci complex in Cyprus. Bull. Ентомол. Res., 99: 573-582

Papayiannis, L.C., T.A. Iacovides, N.I. Katis and J.K. Brown, 2010. Differentiation of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus using real-time TaqMan(r) PCR. J. Virol. Methods, 165: 238-245

Pico, B., M.J. Diez and F. Nuez, 1999. Improved diagnostic techniques for tomato yellow leaf curl virus in tomato breeding programs. Plant Dis., 83: 1006-1012

Tan, X., X. Sun, F.X. Gonzalez-Crussi, F. Gonzalez-Crussi and W. Hsueh, 1994. PAF and TNF increase the precursor of NF-kappa B p50 mRNA in mouse intestine: quantitative analysis by competitive PCR. Lipids Lipid Metabol., 1215: 157-162

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. Higgins, 1997. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 25: 4876-4882

Wittwer, C.T., G.H. Reed, C.N. Gundry, J.G. Vandersteen and R.J. Pryor, 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin. Chem., 49: 853-860

Zakay, Y., N. Navot, M. Zeidan, N. Kedar, H. Rabinowitch, H. Czosnek and D. Zamir, 1991. Screening Lycopersicon accessions for resistance to tomato yellow leaf curl siriv: prevecce of s iral leA acd vyaptoa deselopaect. Plant Dis., 75: 279-281

Zhengxing, L., 1999. Screening for Resistance to Tomato Yellow Leaf Curl Virus, pp: 1-6. Aviac Regiocal Cecter, AVRDC, Shanhua, Taiwan